Score Ranking : RedHead Prison Escape - Help poor redhead escape from prison! Score Ranking : Redhead Prison Escape - Help Redhead Escape from Prison!

152267     PLAYERS HAVE HELPED REDHEAD ESCAPE FROM PRISON: REDHEAD PRISON ESCAPE

1
                           TOP 100 BEST PLAYERS
1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10
#
Level
Name
Message
Date
Score
11CARO FOO FIGHTERS igualito al otro, pero me gusto2013-06-10 23:26:0074889
21ALIANSA T PARA QUE APRENDAN2013-03-08 15:49:0074884
31JOSE DAVID B A Ajajaja Otra Vez Primer Lugar xD2012-11-11 17:59:0074882
41JOSE DAVID B A Siii Porfin Primer Lugar Despues De Tanto xd2012-11-11 17:56:0074881
51ALIANZA T ESTAMOS AVANSANDO PARA QUE APRENDAN PORQUE SOMOS LOS MEJORES2013-03-06 16:56:0074881
61CARO hi2013-05-29 22:13:0074880
71ALIANZA T BUENO Y CORTO2013-03-09 06:17:0074879
81ALIAZA T  VAMOSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS2013-03-06 17:28:0074878
91JUAN MARTIN soy el primero yeeeee2011-02-28 09:25:0074877
101ALIANZA T ALFIN LO LOGRAMOS PARA QUE APRENDAN2013-03-05 16:50:0074876
94/3046
GENERAL RANKING
1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - 20 - 21 - 22 - 23 - 24 - 25
26 - 27 - 28 - 29 - 30 - 31 - 32 - 33 - 34 - 35 - 36 - 37 - 38 - 39 - 40 - 41 - 42 - 43 - 44 - 45 - 46 - 47 - 48 - 49 - 50
51 - 52 - 53 - 54 - 55 - 56 - 57 - 58 - 59 - 60 - 61 - 62 - 63 - 64 - 65 - 66 - 67 - 68 - 69 - 70 - 71 - 72 - 73 - 74 - 75 - 76 - 77 - 78 - 79 - 80 - 81 - 82 - 83 - 84 - 85 - 86 - 87 - 88 - 89 - 90 - 91 - 92 - 93 - 94 - 95 - 96 - 97 - 98 - 99 - 100 -
#
Level
Name
Message
Date
Score
46511JOSEPH LOMAS estuvo bueno el juego2014-02-01 16:29:0074327
46521GTF UJJUH2014-02-01 16:25:0074345
46531LOBO caca2014-02-01 16:23:0074708
46541ROSA es like saludos para mi novio2014-02-01 16:19:0074723
46551IARA esta muy bueno2014-02-01 16:04:0074591
46561DE VUELTA VIKI Y MACA PERO A HORA CON UN AMIGO LLAMANA DO L FUE FACIL2014-02-01 15:47:0074620
46571CHOLAKONDA no esta chida buuuuuuuuuu!!!!!2014-02-01 15:46:0074544
46581ANDREA Hagan uno de 1D, Justin Bieber o 5 Seconds Of Summer!2014-02-01 15:43:0074707
46591GABRIEL esta facil xd2014-02-01 15:34:0073856
46601ZOILA CABEZAS bkjbkhkjb2014-02-01 15:27:0074564
46611HANNYA me gustas mucho2014-02-01 15:14:0074274
46621OLA K ASE quiero a on nom en un juego2014-02-01 15:13:0074677
46631LUKFED A ganar ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡2014-02-01 14:56:0074791
46641JHHIGIGUOGUHO hvjvhjvhlgihbh2014-02-01 14:44:0074684
46651GBNU65YH MN56 NN f1vb a bh2014-02-01 14:39:0074666
46661LUCERO EL ANIME XD xd esta baila baila putta baila2014-02-01 14:39:0074098
46671LISA me gusto2014-02-01 14:32:0073657
46681SOFí!!! MEZA!!! Quisiera que hagan el de Caroline y la puerta secreta !!2014-02-01 14:30:0074281
46691KARLA SARA esta suave el juego2014-02-01 14:26:0074713
46701OLI xd2014-02-01 14:24:0074460
46711VICKY  ggggggguuuuuuuaaaaaaauuuuuuu2014-02-01 14:17:0074203
46721IRUMA otra micion para o bama.2014-02-01 13:46:0073409
46731PHIL Make a Nightmare on elm str game2014-02-01 13:43:0073516
46741GFDAS agan una de esto es suerra2014-02-01 13:39:0074573
46751MALULE buenisima es la primer ves qu elo juego2014-02-01 13:38:0073961
46761LUIS LEONARDO RAFAEL MIGUEL ANGEL chido2014-02-01 13:23:0073887
46771LUCIANO muchas grasias2014-02-01 13:08:0074655
46781 CARSFSDGDUDIFROTGJFNFGHGB que buen juego me justaria una nueva aventura para obama2014-02-01 13:07:0074640
46791TONY COOPER que facil2014-02-01 13:02:0074823
46801MILTON Juegos De Escapar de La Carcel Esos Estan buenisimoos Besooh2014-02-01 13:01:0074774
46811AMERICA CRISTIAN2014-02-01 12:10:0074658
46821GHG ghjgjdffffffffd2014-02-01 11:54:0074657
46831FERY facil2014-02-01 11:54:0074791
46841JUAN jajajajajaja2014-02-01 11:54:0074553
46851CARLOS SANZ 9º juego terminado me gustaria uno de tarzan en selva2014-02-01 11:47:0074601
46861NADIL it bad!!!!!!!!!!!!!!!!!!!!!!!!!2014-02-01 11:43:0074496
46871JORGE esta bueno me diverti2014-02-01 11:34:0073954
46881 SANTIAGOFRANCISCOLAURICONLECHEYMANTECA loooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo ooooooooooooooooool2014-02-01 11:16:0074103
46891DAIANA Estuvo muy facil2014-02-01 10:54:0074259
46901CAMII hagan el juego obama grave encouters2014-02-01 10:51:0074601
46911JUNIOR quiero que salga tadeo jones saw game2014-02-01 10:49:0074321
46921RENATA que juego tan buenisimo demasiado fino2014-02-01 10:40:0073901
46931SOY LA MEJOR 123 esta re bueno2014-02-01 10:38:0074781
46941KARI facil2014-02-01 10:31:0074609
46951JEAK bien2014-02-01 10:28:0074500
46961JIMENA  buenasoooooooooooooooooooooo2014-02-01 10:28:0074826
46971JIMENA buenasooooooooooo2014-02-01 10:23:0074801
46981MAGALI I uno de violetta y leon2014-02-01 10:13:0074818
46991ALEX CAROLINA cuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuulllllllllllllllllllllllllllllllllllllllll lllllllllllllllllll2014-02-01 10:03:0074100
47001ELIURHLUEFRYHIUR wetgety6ty2014-02-01 10:03:0074705